Behavioral Ecology Vol. 15 No. 1: 58-62
© 2004 International Society for Behavioral Ecology
Brood sex ratio in the Kentish plover
a Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY UK b Centre for Behavioural Biology, School of Biological Sciences, University of Bristol, Woodland Road, Bristol BS8 1UG, UK c Department of Biology, Reed College, 3203 SE Woodstock Blvd., Portland, OR 97202, USA d Molecular Laboratory, DEEB, Graham Kerr Building, Glasgow University, Glasgow G12 8QQ, UK e Behavioural Biology Research Group, Department of Ecology, Szent István University, Pf 2, H-1400, Budapest, Hungary
Address correspondence to T. Székely. E-mail: t.szekely{at}bath.ac.uk.
Received 28 November 2001; revised 19 September 2002; accepted 22 January 2003.
| ABSTRACT |
|---|
|
|
|---|
How and why do the mating opportunities of males and females differ in natural population of animals? Previously we showed that females have higher mating opportunities than males in the Kentish plover Charadrius alexandrinus. Both parents incubate the eggs, and males provide more brood care than females; thus it is not obvious why the females find new mates sooner than the males. In this study we investigated whether the sex-biased mating opportunities stem from biased offspring sex ratios. We determined the sex of newly hatched, precocial chicks using CHD gene markers. Among fully sexed broods, 0.461 ± 0.024 (SE) of chicks (454 chicks in 158 broods) were male, and this sex ratio was not significantly different from unity. The proportion of males at hatching decreased significantly over the breeding season, which occurred consistently in all 3 years of the study. Large chicks were more likely to be males than females. Neither parental age nor body size of male and female parents was related to brood sex ratio. We also sexed a number of chicks that were caught after they left their nest (range of estimated ages 017 days) and found that the proportion of males increased with brood age. This relationship remained highly significant when controlling statistically for hatching date. As brood size decreased due to mortality after the chicks left their nest, these results suggest that the mortality of daughters was higher than that of the sons shortly after hatching. Taken together, our results show that the female-biased mating opportunities in the Kentish plover are not due to biased brood sex ratio at hatching but, at least in part, are due to female-biased chick mortality soon after hatching.
Key words: Charadrius alexandrinus, Kentish plover, mating opportunities, parental care, seasonal trends, sex allocation, sex ratio.
| INTRODUCTION |
|---|
|
|
|---|
Fisher's (1930)
Birds had long been considered incapable of facultatively shifting their primary sex ratio because their sex determination is chromosomal (e.g., Clutton-Brock, 1986
). Recent results, however, suggest that sex ratio adjustment in birds is not as constrained as formerly thought (West and Sheldon, 2002
), although the issue is controversial (Palmer, 2000
). For instance, female birds have been shown to skew offspring sex ratio in response to their own body condition (Kalmbach et al., 2001
; Nager et al., 1999
), the attractiveness of their mate (Burley, 1981
; Ellegren et al., 1996
; Sheldon et al., 1999
; but see Grindstaff et al., 2001
; Saino et al., 1999
), the environment (Daan et al., 1996
; Dijkstra et al., 1990
), the social milieu (Komdeur et al., 1997
; reviewed by Hasselquist and Kempenaers, 2002
; Komdeur and Pen, 2002
; Sheldon, 1998
), and hatching order (Ankey, 1982
; Kilner, 1998
). Some of these biased sex ratios appear to be adaptive (Dijkstra et al., 1990
; Kalmbach et al., 2001
; Komdeur et al., 1997
; Nager et al., 1999
), although this has yet to be demonstrated by estimating the long-term reproductive success of male and female offspring produced under different social and environmental conditions.
Kentish plovers are of particular interest for studies of sex ratios because they have flexible mating systems and variable parental care (Amat et al., 1999
; Paton, 1995
). Recently we found that female plovers took significantly less time to remate than males (Székely et al., 1999
). This result seems counterintuitive because the males provide more care than the females: both sexes incubate the eggs, but after hatching typically the female abandons the brood, and the chicks are raised to independence by her deserted mate.
There are four mutually non-exclusive hypotheses for the sex-biased mating opportunities. First, the sex ratio may be biased toward males at egg laying (primary sex ratio; Breitwisch, 1989
) or at hatching (secondary sex ratio), and the bias is preserved until adulthood. Second, survival of chicks differ by sex; for instance, sons may be more likely to reach adulthood than daughters. Third, adult males may survive better each year than adult females. Finally, the breeding schedule of sexes may be different: adult males may breed for longer each year, thereby they produce more broods annually than adult females, and/or males may be able to breed for more years than females.
In this study we investigated the first and second hypotheses; the third and fourth hypotheses are investigated elsewhere (Kis et al., manuscript in preparation; Sandercock et al., unpublished manuscript). In the current study we also analyzed whether offspring sex ratio relates to variables that have been found to be significant in other studiesnamely, hatching date, the size of chick at hatching, and age and size of the parents.
| METHODS |
|---|
|
|
|---|
Field work
We investigated the Kentish plovers at Tuzla Lake, southern Turkey (36° 42' N, 35° 03' E), where they breed in a saltmarsh around the lake. The breeding population was about 1000 pairs. We investigated three sites on the north side of the lake, referred to as sites A (107 ha), B (32 ha), and C (19 ha; see Székely and Cuthill, 1999
Chicks that hatched between 19 May and 14 June 1997, 10 April and 28 June 1998, and 10 April and 7 July 1999 were included in the study; these dates include the peak period of hatching. Nests were visited at least daily near the time of hatching of the eggs. A droplet of blood was taken from newly hatched chicks by puncturing their leg vein using a hypodermic needle. The blood was stored in Eppendorf tubes containing 1 ml of Queen's lysis buffer (Seutin et al., 1991
). We bled 405 chicks (153 broods) in the nest scrape; 143 chicks (57 broods) were bled at first encounter when the chicks had already left the nest scrape (plover chicks are precocial, and they usually leave the nest 112 h after hatching). Both body mass (to the nearest 0.1 g) and tarsus length (to the nearest 0.1 mm) of chicks were measured either in the nest or at the first encounter. We estimated the age of the latter chicks, and thus the date of their hatching, using the equation given by Székely and Cuthill (1999)
. Hatching dates were not different between years (1997: 92.4 ± 1.9 [SE] days after 1 March, n = 17 broods; 1998: 90.0 ± 1.8 days, n = 87 broods; 1999: 90.0 ± 1.8 days, n = 106 broods; Kruskal-Wallis test,
= 0.184, p =.912). The size of sexes is different at hatching (see Results), and thus the estimated ages and hatching dates of chicks may be biased. Therefore, we also calculated the sex-specific growth rates of male and female chicks (16 control families; see Székely and Cuthill, 2000
) and repeated the analyses using the sex-specific estimated ages and hatching dates (see Results).
Parents were caught on their nests using funnel traps, and we measured their body mass, the length of their right tarsus to the nearest 0.1 mm, and their right wing to the nearest 1 mm. Minimum age of parents was the number of years since first captured as an adult + 1, since both males and females may breed in the first year of life (Sandercock et al., unpublished manuscript). Kentish plovers are largely genetically monogamous; the rate of extrapair young is 7.7% (Blomqvist et al., 2002
).
Molecular sexing
We sexed chicks using two CHD genes that lie on the W and Z sex chromosomes of birds (male ZZ; female ZW). The CHD1-Z lies on the Z chromosome and is polymerase chain reaction-amplified as a positive control in both sexes. In contrast, the CHD1-W can only be amplified in one sex, and it indicates the bird is female (Griffiths et al., 1998
). We sexed 277 chicks using the following reaction conditions in the laboratory of R. Griffiths: a 10 µl total reaction volume with 6 pmol P2 (TCTGCATCGCTAAATCCTTT) and P8 (CTCCCAAGGATGAG(A/G)AA(C/T)TG) primers), 200 µM of each dNTP, 50100 ng target DNA, 0.35 units Taq polymerase, 1.5 mM MgCl2, 50 mM KCl, 10 mM TrisHCl (pH 8.8 at 25°C), 0.1% Triton X-100 (the last four in Promega in "with Mg/Taq buffer"). The thermal conditions were an initial 94°C for 90 s followed by 30 cycles of 48°C for 45 s, 72°C for 45 s, 94°C for 30 s, with a final 48°C for 60 s and 72°C for 300 s. A separate group of 271 chicks was sexed in the laboratory of S. Yezerinac as above, but with the following differences: 0.5 units Taq polymerase, 3.5 mM MgCl2, 25 mM KCl, 10 mM TrisHCl (pH 9 at 25°C); the thermal conditions were an initial 94°C for 150 s followed by 30 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 30 s with a final 72°C for 270 s; following polymerase chain reaction (PCR), these samples were digested with 5 U HaeIII (New England Biolabs) for 2 h according to the manufacturer's recommended conditions. For both sets of chicks, the PCR products were visualized in a 3% agarose gel stained with ethidium bromide. Thirteen chicks were run twice in a blind test with identical results using the second method. We captured 10 male and 13 female chicks as adults and sexed using plumage characters; all 23 matched the result of molecular sexing from their previous blood sample.
Statistical analysis
Three females and five males produced more than one brood either within a year or between years; for these adults only one randomly selected brood was included in the analyses. The analyses were carried out using three sets of data. First, we included only complete broods (454 chicks in 158 broods)broods in which (1) all hatched chicks were bled while the chicks were in the nest (367 chicks in 129 broods), and (2) broods of three (the modal clutch and brood size) that were caught before the chicks reached 4 days of age (1.97 ± 0.24 [SE] days, 87 chicks in 29 broods). Second, we restricted the analyses to those nests in which all eggs that were laid hatched (335 chicks in 112 broods) to avoid the potential influence of partial nest predation on hatchling sex ratios. Third, we used the full data set and included all broods that were either captured in the nest or off the nest (548 chicks in 210 broods, range of ages: 017 days).
The number of male chicks in broods of three was tested against the binomial distribution (q = 0.5). Then we fitted generalized linear mixed models (GLMMs; Krackow and Tkadlec, 2001
) with binomial error and logit function (Genstat 4.2, VSN International Ltd, Oxford). In GLMMs the sex of chick was the response variable, the brood identifier was a random factor, and the dispersion parameter was set to 1.0. First we carried out bivariate GLMMs in which the explanatory variables were year and site (fixed factors), and hatching date, brood size, age of parents, and sizes of males, females, and their chicks were fixed variables. The probabilities of these bivariate analyses were corrected using the sequential Bonferroni method (Rice, 1989
), where the probabilities were calculated using the Dunn-
idák formula (Sokal and Rohlf, 1981
): pc = 1 - (1 - 0.05)1/N, where N = 1 for the first candidate explanatory variable, and N = 12 (or 13) for the last explanatory variable (see Tables 1 and 2). Second, as hatching date, chick size, or brood age were significantly related to chick sex (see Results), we repeated all analyses by including hatching date and chick size (Table 1) or hatching date and brood age in the analyses (Table 2). Third, we included two-way interactions between explanatory variables and hatching date in the GLMMs (Tables 1 and 2), but none were significant and thus these are not reported. For the explanatory variables we provide the Wald statistic that has an approximately chi-square distribution. We calculated correlations by either Pearson correlation coefficient (r) or Spearman rank correlation (rs) as appropriate. Data are represented as means ± SE, and we provide two-tailed probabilities.
|
|
| RESULTS |
|---|
|
|
|---|
Brood sex ratio
The proportion of males in freshly hatched complete broods was 0.461 ± 0.024 (454 chicks in 158 broods). This was not different from 0.5 (Wilcoxon signed rank test, T158 = 4773, p =.123). The distribution of males in broods of three chicks was not different from binomial (chi-square goodness of fit, n = 140 broods,
2 = 2.933, 3 df, p >.4; Figure 1).
|
These results remained qualitatively unchanged when only those broods were considered in which all eggs that were laid hatched, and all hatchlings were sexed (335 chicks in 112 broods). The proportion of males (0.454 ± 0.027) remained nonsignificantly different from 0.5 (Wilcoxon signed rank test, T112 = 2616, p =.148), and the distribution of males remained not different from binomial in broods of three chicks (chi-square goodness of fit, n = 111 broods,
2 = 4.484, 3 df, p >.4).
Brood sex ratio, environment, chick size and parental qualities
The proportion of males decreased over the breeding season (454 chicks in 158 broods; Table 1, Figure 2): the estimated proportion of males early in the season was 0.555 (day 60) using binary logistic regression, which declined to 0.378 in late season (day 120; Figure 2).
|
Study site, brood size, and year of hatching were all unrelated to brood sex ratio. The interaction between year and hatching date was not significant (GLMM, Wald statistic
2 = 2.77, 2 df, p =.250), nor was year significant (Wald statistic
2 = 0.95, p =.623). However, hatching date was significant (Wald statistic
2 = 3.91, 1 df, p =.048), suggesting that brood sex ratio became progressively female biased over the breeding season each year. Age, body mass, and tarsus length of either parent were unrelated to brood sex ratio (Table 1). Large chicks (as indicated by their tarsus length) were more often males than females (Table 1). This relationship remained significant when controlling for hatching date (Table 1). The latter result suggests that although chick size increased over the breeding season (r =.158, n = 158 broods, p =.047), larger chicks were more likely to be males throughout the breeding season.
These results were consistent with the analyses of the full data set (548 chicks in 210 broods) in that the proportion of sons decreased over the season (Table 2). This relationship remained significant by adjusting the significance level using the sequential Dunn-
idák correction (pc =.05, Table 2). In addition, broods captured at an older age had more sons than broods caught at a younger age (Table 2; Figure 3). The latter relationship remained highly significant when we used sex-specific growth rates to estimate the ages of sons and daughters that were captured off-nest (see Methods; GLMM, brood age Wald statistic
2 = 8.44, 1 df, p =.004; hatching date Wald statistic
2 = 11.33, 1 df, p <.001). Because brood size decreased with brood age (rs = -.318, n = 57 broods, p =.016), the latter results suggest that daughters died more often than sons shortly after hatching.
|
| DISCUSSION |
|---|
|
|
|---|
Our study provided two main results. First, offspring sex ratio was not biased at the population level. This result was consistent for both the secondary sex ratio (i.e., at the time of hatching of young) and for primary sex ratio (i.e., sex ratio of eggs). We note, however, that there was a nonsignificant trend toward more females. These results thus show that the biased mating opportunities are not due to biased sex ratio at laying of the eggs; thus either the differential mortality of the sexes (see below) or their different breeding schedules produce the female-biased mating opportunities throughout the breeding season.
Second, we found a seasonal trend in brood sex ratio: there was a tendency for a greater proportion of males in early broods, whereas late ones were mostly females. This is the first demonstration of seasonal variation in sex ratio of precocial birds to our knowledge; previous studies of waterfowl did not detect difference in hatchling sex ratios between early and late in the season (Blums and Mednis, 1996
). This seasonal pattern was consistent among 3 years of study, and it raises two questions. (1) What is the mechanism of the seasonal variation? One explanation may be that each female shifts facultatively the sex ratio of her offspring over the season. Such shifts may occur if offspring sex ratio is influenced by female condition and the condition of females decreases over the breeding season. For instance, female gulls and skuas in poor body condition overproduce the smaller sex (Kalmbach et al., 2001
; Nager et al., 1999
). This explanation seems unlikely in the Kentish plover because the seasonal shift in brood sex ratio remained significant when chick size was statistically controlled for, and there were no relationships between sex ratio and female body size or mass. On the other hand, each female may have a characteristic brood sex ratio, and these females may breed at different times. For instance, a seasonal shift may emerge if old females produce mostly male offspring and these females breed early in the season. Age-dependent timing of breeding is well known in birds (Forslund and Part, 1995
; Saether, 1990
), although it is not known whether brood sex ratio varies according to the age of female. In our study brood sex ratio was unrelated to the minimum age of female (Tables 1 and 2).
(2) What are the gains from biasing the sex ratio over the season? Differential gains may arise if survival or breeding success of one sex (or both sexes) depends on hatching date. For instance, proportion of males increases with laying date in spotless starlings (Cordero et al., 2001
), a pattern opposite to the one we found in the Kentish plover. Cordero et al. (2001)
argued that the seasonal shift in sex ratio is driven by the selective advantage of early-hatched females because females hatched early had a higher chance of breeding in their first breeding season. We do not know yet whether breeding or survival of Kentish plover chicks depends on their hatching date, although we note that competition among males for breeding territories is severe, and males do attempt to breed in their first year. These observations suggest that the reproductive success of males may depend more on hatching date than the reproductive success of females. Alternatively, higher food availability early in the season may favor the faster growing male chicks (see below).
In this study we identified two ways in which a biased adult sex ratio may emerge from unbiased sex ratios at hatching. First, the mortality of female chicks was higher than the mortality of male chicks. Growth rates of males (0.414 ± 0.017 mm/day) appear to be higher than the growth rates of females (0.378 ± 0.021 mm/day), and thus perhaps female chicks are more vulnerable to predation or infanticide. Behavioral studies of individually marked chicks are needed to clarify this issue. Second, late broods tended to have more female chicks. Previously we showed that brood mortality increases over the breeding season (Székely and Cuthill, 1999
), perhaps due to shrinking foraging habitats, so the slow-growing female chicks may have relatively high survival chances at low food availabilities. Taken together, the high mortality of females, particularly in broods late in the season, may bias the sex ratio at fledglings of the chicks; thus fewer young females are recruited to the breeding population than young males.
In conclusion, we found no evidence that the overall brood sex ratio is biased in the Kentish plover at the hatching of the chicks. However, we identified two routes to produce sex-biased mating opportunities: differential mortality of broods over the breeding season and differential mortality of sons and daughters shortly after hatching. Future studies will be invaluable to reveal whether these routes may fully explain the adult sex ratio in the population and evaluate the significance of population sex ratios for the evolution of mating and parental behaviors.
| ACKNOWLEDGEMENTS |
|---|
The project was funded by a Natural Environment Research Council grant to Alasdair Houston, ICC, and John McNamara (GR3/10957), by an Orszagos Tudomanyos Kutatsi Alap grant to T.S. (T031706), and by a grant from the Hungarian Ministry of Education to Z. Barta and T.S. (FKFP-0470/2000). Research funded in part by a grant to S.Y. from the Howard Hughes Medical Institute and the Dean's Office of Reed College. Rings were provided by the late Peter Evans (Durham University) and Radolfzell Vögelwarte, Germany. We thank András Kosztolányi, Adam Lendvai, István Szentirmai, and Yusuf Demirhan for their assistance in the field. Tuluhan Yilmaz and Süha Berberoglu (Çukurova University, Adana) and Özay Karabaçak (National Park Authority, Adana) helped us with the logistics of the field work. Permissions for field work and blood sampling were provided by the Turkish Ministry of National Parks.
| REFERENCES |
|---|
|
|
|---|
Amat JA, Fraga RM, Arroyo GM, 1999. Brood desertion and polygamous breeding in the Kentish plover Charadrius alexandrinus. Ibis 141:596-607.
Ankey CD, 1982. Sex ratio varies with egg sequence in lesser snow geese. Auk 99:662-666.
Blomqvist D, Andersson M, Küpper C, Cuthill IC, Kis J, Lanctot RB, Sandercock BK, Székely T, Wallander J, Kempenaers B, 2002. Genetic similarity between mates explains extra-pair parentage in three species of waders. Nature 419:613-615.[CrossRef][Medline]
Blums P, Mednis A, 1996. Secondary sex ratio in Anatinae. Auk 113:505-511.
Breitwisch R, 1989. Mortality patterns, sex ratios, and parental investment in monogamous birds. Curr Ornithol 6:1-50.
Burley N, 1981. Sex ratio manipulation and selection for attractiveness. Science 211:711-722.
Clutton-Brock TH, 1986. Sex-ratio variation in birds. Ibis 128:317-329.
Cordero PJ, Vinuela J, Aparicio JM, Veiga JP, 2001. Seasonal variation in sex ratio and sexual egg dimorphism favouring daughters in first clutches of the spotless starling. J Evol Biol 14:829-834.[CrossRef]
Daan S, Dijkstra C, Weissing FJ, 1996. An evolutionary explanation for seasonal trends in avian sex ratios. Behav Ecol 7:426-430.
Dijkstra C, Bult A, Bijlsma S, Daan S, Meijer T, Zijlsstra, M., 1990. Brood size manipulations in the kestrel Falco tinnunculus: effects on offspring and parent survival. J Anim Ecol 59:269-286.[CrossRef]
Ellegren H, Gustafsson L, Sheldon BC, 1996. Sex ratio adjustment in relation to parental attractiveness in a wild bird population. Proc Natl Acad Sci USA 93:723-728.
Fisher R, 1930. The genetical theory of natural selection. Oxford: Oxford University Press.
Forslund P, Part T, 1995. Age and reproduction in birds: hypotheses and tests. Trends Ecol Evol 10:374-378.[CrossRef]
Griffiths R, Double M, Orr K, Dawson R, 1998. A simple DNA test to sex most birds. Mol Ecol 7:1071-1076.[CrossRef][Medline]
Grindstaff JL, Buerkle CA, Casto JM, Nolan V, Jr, Ketterson ED, 2001. Offspring sex ratio is unrelated to male attractiveness in dark-eyed juncos (Junco hyemalis). Behav Ecol Sociobiol 50:312-316.[CrossRef]
Hamilton WD, 1967. Extraordinary sex ratios. Science 156:477-488.
Hasselquist D, Kempenaers B, 2002. Parental care and adaptive brood sex ratio manipulation in birds. Phil Trans R Soc 357:363-372.
Kalmbach E, Nager RG, Griffiths R, Furness RW, 2001. Increased reproductive effort results in male-biased offspring sex ratio: an experimental study in a species with reversed sexual size dimorphism. Proc R Soc Lond 268:2175-2179.[Medline]
Kilner R, 1998. Primary and secondary sex ratio manipulation by zebra finches. Anim Behav 56:155-164.[CrossRef][ISI][Medline]
Komdeur J, Daan S, Tinbergen J, Mateman AC, 1997. Extreme adaptive modification in sex ratio of the Seychelles warbler's eggs. Nature 385:522-525.[CrossRef]
Komdeur J, Pen I, 2002. Adaptive sex allocation in birds: the complexities of linking theory and practice. Phil Trans R Soc 357:373-380.
Krackow S, Tkadlec E, 2001. Analysis of brood sex ratios: implications of offspring clustering. Behav Ecol Sociobiol 50:293-301.[CrossRef]
Leimar O, 1996. Life-history analysis of the Trivers and Willard sex-ratio problem. Behav Ecol 7:316-325.
Nager RG, Monaghan P, Griffiths R, Houston DC, Dawson R, 1999. Experimental demonstration that offspring sex ratio varies with maternal condition. Proc Natl Acad Sci USA 96:570-573.
Palmer AR, 2000. Quasireplication and the contract of error: lessons from sex ratios, heritabilities and fluctuating asymmetry. Annu Rev Ecol Syst 31:441-480.[CrossRef][ISI]
Paton PWC, 1995. Breeding biology of snowy plovers at Great Salt Lake, Utah. Wilson Bull 107:275-288.
Rice WR, 1989. Analyzing tables of statistical tests. Evolution 43:223-225.[CrossRef][ISI]
Saether B-E, 1990. Age-specific variation in reproductive performance in birds. Curr Ornithol 7:251-283.
Saino NE, Ellegren H, Møller AP, 1999. No evidence for adjustment of sex allocation in relation to parental ornamentation and paternity in barn swallow. Mol Ecol 8:399-406.[CrossRef]
Seutin G, White BN, Boag PT, 1991. Preservation of avian blood and tissue samples for DNA analyses. Can J Zool 69:82-90.
Sheldon BC, 1998. Recent studies of avian sex ratios. Heredity 80:397-402.[CrossRef]
Sheldon BC, Andersson S, Griffith SC, Örnborg J, Sendecka J, 1999. Ultraviolet colour variation influences blue tit sex ratios. Nature 402:874-877.[CrossRef]
Sokal R, Rohlf J, 1981. Biometry. WH Freeman, New York.
Székely T, Cuthill IC, 1999. Brood desertion in Kentish plover: the value of parental care. Behav Ecol 10:191-197.
Székely T, Cuthill IC, 2000. Trade-off between mating opportunities and parental care: brood desertion by female Kentish plovers. Proc R Soc Lond B 267:2087-2092.[Medline]
Székely T, Cuthill IC, Kis J, 1999. Brood desertion in Kentish plover: sex differences in remating opportunities. Behav Ecol 10:185-190.
Trivers RL, Willard DE, 1973. Natural selection of parental ability to vary the sex ratio of offspring. Science 179:90-92.
West SA, Sheldon BC, 2002. Constraints in the evolution of sex ratio adjustment. Science 295:1685-1688.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


) as given by the binary logistic regression equation [G(loge[