Skip Navigation


Behavioral Ecology Advance Access originally published online on December 5, 2006
Behavioral Ecology 2007 18(2):292-297; doi:10.1093/beheco/arl082
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/2/292    most recent
arl082v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Vogel, E. R.
Right arrow Articles by Dominy, N. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Vogel, E. R.
Right arrow Articles by Dominy, N. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the International Society for Behavioral Ecology. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Effect of color vision phenotype on the foraging of wild white-faced capuchins, Cebus capucinus

Erin R. Vogela, Maureen Neitzb and Nathaniel J. Dominya

a Department of Anthropology, 1156 High Street, University of California, Santa Cruz, CA 95064, USA b Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226, USA

Address correspondence to N.J. Dominy. E-mail: njdominy{at}ucsc.edu.

Received 21 December 2005; revised 21 August 2006; accepted 2 November 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
New World monkeys exhibit a color vision polymorphism. It results from allelic variation of the single-locus middle-to-long wavelength opsin gene on the X chromosome. Females that are heterozygous for the gene possess trichromatic vision. All other individuals possess dichromatic vision. The prevailing hypothesis for the maintenance of the color vision polymorphism is through a consistent fitness advantage to heterozygous trichromatic females. Such females are predicted to be more efficient than dichromats when detecting and selecting fruit. Recent experiments with captive callitrichid primates provided support for this hypothesis by demonstrating that color vision phenotype affects behavioral responses to contrived food targets. Yet, the assumptions that trichromatic females acquire more calories from fruit, or that number of offspring is linked to caloric intake, remain untested. Here, we assess if, in the wild, heterozygous trichromatic individuals in a group of white-faced capuchins (Cebus capucinus) enjoy an energetic advantage over dichromats when foraging on fruit. Contrary to the assumptions of previous theoretical and experimental studies, our analysis of C. capucinus foraging behavior shows that trichromats do not differ from dichromats in their fruit or energy acquisition rates. For white-faced capuchins, the advantage of trichromatic vision may be related to the detection of predators, animal prey, or fruit under mesopic conditions. This result demonstrates the importance of using a fitness currency that is relevant to individual animals to test evolutionary hypotheses.

Key words: frugivory, M/L cone opsin polymorphism, primates, trichromatic vision.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Variation exists in the color vision of New World monkeys (Platyrrhini). Like most platyrrhines, the genus Cebus is characterized by a color vision polymorphism. The polymorphism results from allelic variation of the single-locus middle-to-long wavelength (M/L) opsin gene on the X chromosome (Mollon et al. 1984Go; Jacobs et al. 1993Go). The presence in the population of 3 alleles coding for different M/L photopigments results in a variety of color vision phenotypes. Females that are heterozygous for the M/L opsin gene possess trichromatic vision. All other individuals possess dichromatic vision (Jacobs and Neitz 1987Go; Lee et al. 2000Go; Jacobs and Deegan 2003Go). The polymorphism appears to be maintained by balancing selection (Boissinot et al. 1998Go; Surridge and Mundy 2002Go), although the major mechanisms acting to maintain allelic variation in platyrrhine populations are poorly understood (Surridge et al. 2003Go).

The prevailing hypothesis for the maintenance of the polymorphism is through a consistent fitness advantage to heterozygous trichromatic females (Mollon et al. 1984Go). Such females are predicted to have an advantage when foraging on fruit (Regan et al. 2001Go), particularly those characterized as yellow, orange, or red (Mollon 1989Go; Párraga et al. 2002Go). Recent experiments with captive callitrichid primates have provided some support for this hypothesis. For instance, Caine and Mundy (2000)Go demonstrated an advantage in feeding rate for trichromatic marmosets (Callithrix geoffroyi) competing for orange cereal balls scattered on the floor of their enclosure. The result suggests an advantage for trichromats based on food color, but in a second test where the food was presented at close range (<0.5 m), the difference between dichromats and trichromats disappeared. Similarly, Smith et al. (2003)Go demonstrated an advantage in feeding rate for trichromatic tamarins (Saguinus fuscicollis and Saguinus labiatus) scrambling for chromatically naturalistic food targets fixed to a background of simulated leaves. Interestingly, the total number of food targets acquired during the 15-min test period did not depend on the color vision phenotype, suggesting that a persistent dichromat may in the end acquire the same total harvest as a trichromat.

Such experiments demonstrate that color vision can affect behavioral responses to environmental stimuli, particularly the rate at which foods are acquired. Yet, the assumption that an advantage in food acquisition rate results in an energetic and fitness advantage remains implicit and untested. To achieve a more complete understanding of the evolution of platyrrhine color vision, it is necessary to observe the natural foraging behavior of primates and to select a currency that is relevant to individual fitness (Crone 2001Go). The currency should directly impact individual survival or reproduction and must not trade off with another relevant fitness currency (Burns 2005Go). For Cebus capucinus, which devotes 81–85% of its foraging time to consuming fruit (Chapman 1987Go; Vogel 2004Go), female fitness is likely to be closely linked to both the rate and the quality of fruit acquisition. It follows that energy-intake rates will be higher among phenotypes that learn the difference between rewarding and unrewarding fruits on the basis of color, and therefore make more accurate foraging decisions (Dall et al. 2005Go).

It stands to reason therefore that heterozygous trichromatic females may select fruits and acquire energy from fruits at faster rates than dichromatic phenotypes. Here, we test this prediction. We genotyped the M/L opsin genes of a group of wild white-faced capuchins (C. capucinus) to ask the following questions: first, do trichromatic females have a higher energy-intake rate than dichromats? And, second, does the energetic advantage, if it exists, extend to a particular species or class of fruit?


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study site and subjects
White-faced capuchins were studied in the Lomas Barbudal Biological Reserve and surrounding properties, Guanacaste Province, northwest Costa Rica (10°30'N and 85°22'W). The 2279-ha reserve is classified as a tropical deciduous forest (Frankie et al. 1988Go). Observational data were collected from 1 study group, Group QQ, from January to July 2002, for a total of 1950 h (Vogel 2005Go). Group QQ was composed of 4 adult males, 9 adult females, 1 subadult male and female, 7 juveniles, and 4–5 infants. Their home range covered 276 ha.

Behavioral and ecological data
During feeding bouts, 1-min feeding rate samples were recorded for as many individuals as possible within a tree (Vogel 2005Go). The tree species, the number of food items ingested, and the amount of time spent in processing foods were recorded. From these data, feeding rates (number of fruits ingested per min) were calculated. If more than 1 feeding rate was collected for an individual during a feeding bout, the feeding rates were averaged for the individual. The density of fruit in each tree and the density of the trees themselves were also calculated. The energy-intake rate was estimated as the product of the number of fruits ingested per min x g dry mass of each fruit x kJ/g dry mass of each fruit. This metric was calculated for 1–20 focal animals for each of 17 tree species (Table 1). The total energy available in a tree crown was calculated as the product of the abundance and kJ/g dry mass per fruit, divided by the tree crown volume. The hues of edible fruits are presented in Table 1; they were grouped into 2 classes based loosely on their chromatic conspicuousness to trichromatic primates: 1) yellow/orange/red fruits (conspicuous fruits) and 2) green and brown fruits (cryptic fruits).


View this table:
[in this window]
[in a new window]

 
Table 1 Trees used in the analysis of Group QQ foraging behavior

 
Amplification and sequencing of the M/L cone opsin gene
Fecal samples (ca., 5 g each) were collected from individual animals. The samples were stored at ambient field temperatures in 50-ml tubes containing 20 g silica gel beads (Nsubuga et al. 2004Go). Samples were later transported to the University of Chicago and stored at 4 °C. We extracted genomic DNA with a QIAamp DNA Stool Mini Kit (Qiagen, Valencia, CA). We modified Step 2 of the manufacturer instructions: samples were mixed with 1.6 ml ASL buffer and incubated at room temperature for 3 h.

The {lambda}max of the M/L ospin gene can be predicted from the amino acid composition of 3 sites: site 180 encoded by exon 3 and sites 277 and 285 encoded by exon 5 (Nathans et al. 1986Go; Neitz M and Neitz J 1998Go). Amino acid changes from Ser to Ala at site 180 (denoted Ser180Ala), Tyr277Phe, and Thr285Ala shift the {lambda}max values by –7, –8, and –15 nm, respectively, although estimates of {lambda}max can vary slightly (Neitz et al. 1991Go; Merbs and Nathans 1992Go; Asenjo et al. 1994Go; Yokoyama and Radlwimmer 2001Go).

The polymerase chain reaction (PCR) was used to amplify exons 3 and 5 of the M/L opsin gene (Neitz M and Neitz J 1995Go). Exons 3 and 5 were amplified separately using the AmpliTaq Gold PCR kit per manufacturer instructions (ABI, Foster City, CA). Each 50-µl PCR reaction contained a final concentration of 1x Buffer, 1 mM MgCl2, 600 nM of each primer, 50 µM each of dATP, dCTP, dTTP, and dGTP, and 1.25 units of AmpliTaq Gold (ABI). Exon 3 was amplified using the forward primer 5' CGTCTGTCTGCTCTCCCCTA and the reverse primer 5' TTGCCTCAGGGTCACAGAGT. One or 2 rounds of PCR were done in an ABI 2700 Thermal Cycler using cycling conditions of 94 °C for 9 min for 1 cycle, followed by 37 cycles of 94 °C for 45 s, 61 °C for 45 s, 72 °C for 45 s. Reactions were then incubated at 72 °C for 7 min and stored at 4 °C. Exon 5 was amplified using the forward primer 5' GTGGCAAAGCAGCAGAAAG and the reverse primer 5' CTGCCGGTTCATAAAGACATAG or using the forward primer 5' TCCACCCCCCGACTCACTATCC and the reverse primer 5' ACGGTATTTTGAGTGGGATCTGCT. The thermal cycling conditions were the same as those used to amplify exon 3 except that the 61 °C step was done at 59 °C. PCR products were directly sequenced using the same primers that were used to amplify the exons and the BigDye Terminator 3.1 kit (ABI). Sequencing reactions were analyzed on an ABI 3100 Avante.

Allelic dropout is a potentially confounding factor in this analysis (Knapp 2005Go). Because the possibility of allelic dropout could not be ruled out for one homozygous adult female, this female was excluded from all analyses. Accordingly, a total of 22 animals served as subjects for these analyses (9 adult/subadult females, 4 juvenile females, 7 adult/subadult males, and 2 juvenile males).

Statistical analyses
Our analysis is based on 481 feeding rates collected during 210 independent focal tree samples. Linear multiple regression models were used to predict the effect of visual phenotype (dichromatic or trichromatic) on the feeding and energy-intake rates of all individuals and for a separate analysis of adult females. The assumptions of homoscedasticity and normality of residuals were tested; in nearly all cases, taking the logarithm of the original data brought the data into conformity with these assumptions (Sokal and Rohlf 1995Go). All variables were checked for independence using pairwise correlation techniques.

We ran each model twice, once with fruit-intake rate as the dependent variable and once with energy-intake rate as the dependent variable. Because variables other than color vision phenotype can contribute to variation in individual foraging behavior, we included them in the multiple regression models. The variables were: 1) the percentage of aggression won, 2) sex, 3) fruit density within a tree, 4) total energy within a tree crown, and 5) tree species. The percentage of aggression won is a measure of dominance rank. It is calculated as the ratio of aggressive interactions won to the total number of interactions in which the individual participated (Janson 1985Go). These data were arcsine transformed. In a previous study, dominance rank correlated with both feeding and energy-intake rates (Vogel 2004, 2005GoGo). Fruit density and the energy available within a tree crown are also significant predictors of feeding rates and energy-intake rates, respectively (Vogel 2004, 2005GoGo). Accordingly, we included fruit density in models predicting feeding rates and crown energy density in models predicting energy-intake rates. Lastly, there is a large amount of variation in average feeding rates and average energy-intake rates for several tree species (Vogel 2005Go). Tree species were therefore included in the multiple regression models; the variable accounted for 49–85% of the variation in energy-intake rates among focal animal samples.

When categorical data were included in a model (e.g., species, phenotype, sex), JMP-SAS 5.0.1a converted the categorical values (levels) into internal columns of numbers and analyzed the data as a linear model. The program uses a sum-to-zero coding scheme to create indicator variables and provides information on how different the mean for a specific level was from the mean of the means for each level and also provides directional effects (Sall et al. 2001Go). Lastly, given our relatively small sample sizes, a power analysis was conducted for all tests. The one analysis with insufficient power to detect a significant result was the test for phenotypic differences in fruit and energy-intake rates among adult females. The analysis revealed that the number of data points in our sample was insufficient to achieve significance (least significant number = 519, 552, respectively) and that the overall power of the phenotype estimate was relatively low (power = 0.30, 0.28, respectively). All possibility levels are 2-tailed, and significance for all tests was set at alpha 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Variation in M/L opsin alleles
We detected varying residues at positions 180, 277, and 285 of the M/L opsin gene that are predicted to yield pigments with {lambda}max values of 535, 549, and 562 nm (Jacobs and Neitz 1987Go; Jacobs and Deegan 2003Go). Although the spectral peaks of Cebus pigments may vary somewhat depending on the measurement methodology employed, for example, electroretinogram flicker photometry (above), microspectrophotometry (535, 550, 563 nm; Bowmaker et al. 1983Go; Hunt et al. 1998Go), or in vitro pigment reconstitution (530, 545, 560 nm; Hiramatsu et al. 2005Go) their relative positions do not. Table 2 shows the distribution of alleles and inferred phenotypes among individuals in Group QQ. The allele frequencies of P535, P549, and P562 were 45%, 10%, and 45%, respectively, in a total of 29 X chromosomes examined for the group. Six out of 11 females (55%) were heterozygous and are thus predicted to have different types of M/L cone pigment. Two of the 3 possible trichromatic phenotypes (P535/P562 and P549/P562) were observed. The P549/P562 combination is equivalent to human anomalous trichromacy. As expected, all males examined were dichromats.


View this table:
[in this window]
[in a new window]

 
Table 2 Distribution of alleles and inferred phenotypes (P) among individuals in Group QQ

 
Phenotypic variation in foraging
The multiple regression models were significant (P < 0.0001). Overall, there was no difference between dichromats and trichromats in feeding rate and energy-intake rate (Table 3). There was a trend, although not statistically significant, toward an overall dichromatic advantage (Table 3). When only yellow/orange/red (conspicuous) fruits were included in the model, there was no difference between dichromats and trichromats in feeding rates or energy-intake rates (F1,324 = 2.50, P = 0.12; F1,324 = 3.03, P = 0.09, respectively). The same result held for feeding rates and energy-intake rates when only cryptic were included in the analysis (F1,102 = 0.81, P = 0.37; F1,102 = 0.22, P = 0.63, respectively). The sex of the animal had no effect on feeding rate or energy-intake rate, a result consistent with past studies (Vogel 2005Go). In a separate analysis of adult females, there was no difference in feeding rates and energy-intake rates between dichromats and trichromats when all fruits were included in the analysis, when only yellow/orange/red fruits were included in the analysis, or when only cryptic fruits were included in the analysis (Table 4), although the overall power of this analysis was low.


View this table:
[in this window]
[in a new window]

 
Table 3 Effect of phenotype on feeding and energy-intake rates for all individuals on all fruits

 

View this table:
[in this window]
[in a new window]

 
Table 4 Log transformed feeding and energy-intake rates for adult females when feeding on all fruits (n = 270 feeding events), yellow/orange/red conspicuous fruits (n = 213 feeding events), and green and brown cryptic fruits (n = 57 feeding events)

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We detected 3 M/L opsin gene alleles in a population of C. capucinus that are predicted to yield pigments with {lambda}max values of 535, 549, and 562 nm. This result is consistent with previous genetic examinations of Cebus apella (Hunt et al. 1998Go), C. capucinus (Hiramatsu et al. 2005Go), and Cebus olivaceus (=Cebus nigrivittatus; Shyue et al. 1998Go). An analysis of fruit foraging revealed no difference between trichromatic and dichromatic phenotypes when variables known to affect individual foraging success were controlled for statistically. In fact, there was a nonsignificant trend toward dichromats having an overall foraging advantage. Our findings are inconsistent with the hypothesis of heterozygote advantage, at least in the context of wild capuchins foraging on fruits, chromatically conspicuous or otherwise.

However, 2 methodological issues pertain to our analysis. First, the anthropogenic assignment of fruits into hue categories may be inadequate for testing hypotheses relating color signals to the perception of nonhuman receivers. Such hypotheses should be addressed by quantifying the color of targets and distracters in a way that is appropriate for the animals under consideration. Although yellow, orange, and red fruits are chromatically conspicuous to trichromatic capuchins (Regan et al. 2001Go), other aspects of the fruit, such as brightness contrast (Schmidt et al. 2004Go), may be salient to dichromats. It is estimated that dichromatic spider monkeys (Ateles geoffroyi) can detect 94–97% of fruit species detectable to trichromatic phenotypes (Riba-Hernández et al. 2004Go; Stoner et al. 2005Go). Second, our results are based on a retrospective analysis of genetic samples collected during a study of aggression (Vogel 2004Go). Variation in the selection of fruits within a tree crown was not recorded. It is possible that dichromats and trichromats selected fruits of different caloric values within a feeding tree. Although our protocol may have missed subtle intratree variation in individual foraging behavior, it has the advantage that the original observers were unaware of the hypothesis that was later tested.

If the above factors confounded our analysis—and if fruit color is a reliable signal of energy content within or between trees (Lucas et al. 2003Go; Riba-Hernández et al. 2005Go)—it follows that a comparatively high fruit-intake rate should exist among dichromats to compensate for the selection of lower energy fruits, that is quick-and-compulsive selection instead of a slow-and-accurate selection (Chittka et al. 2003Go; Dyer and Chittka 2004Go). This prediction was not met: dichromatic and trichromatic capuchins did not differ in their overall fruit-intake rates, although dichromats may have compensated by foraging longer overall, as they do in captivity (Saito et al. 2005Go). Our analysis of 8 females (5 dichromats and 3 trichromats) also failed to detect a difference in fruit-intake rate, although this result is best considered provisional due to the relatively low statistical power of our analysis. With so few females we cannot exclude the possibility of a Type II error; trichromatic females may in fact acquire fruit at faster rates than dichromatic females.

Our results are the first to suggest that trichromatic advantages observed among captive callitrichids (based on food-intake rate) may not extend more generally to wild primates. Such artifacts of captivity have been observed in birds. For instance, Schmidt and Schaefer (2004)Go reported an unlearned preference for red artificial fruits among ecologically naive blackcaps (Sylvia atricapilla), although no preference existed among wild-caught individuals. Overall, it is difficult to link the photopigments of primates, particularly those of cebid monkeys, with aspects of their foraging ecology (Cropp et al. 2002Go; cf., Talebi et al. 2006Go). Our results also raise questions concerning the maintenance of the M/L cone opsin polymorphism.

The factors contributing to the maintenance of the platyrrhine M/L cone opsin polymorphism are a puzzle, but selection for finding food may be important. It has long been hypothesized that the polymorphism is maintained because heterozygous females enjoy a fitness advantage when foraging for ripe, energy-rich fruit, and that the number of offspring is reasonably linked to calorie intake (Regan et al. 2001Go). The results of visual detection experiments with colorblind humans and callitrichid primates are consistent with this hypothesis (Caine and Mundy 2000Go; Smith et al. 2003Go; Cole et al. 2004Go; Rowe and Jacobs 2004Go). Here, we conclude that, in the wild, trichromatic phenotypes of C. capucinus may not enjoy the energetic advantages assumed in some of these studies. Yet, variations in particular allele frequencies suggest that a heterozygote advantage exists, particularly under dim light conditions (Osorio et al. 2004Go). Our results might therefore reflect a degree of phenotypic parity in the relatively high light conditions of a deciduous forest (Yamashita et al. 2005Go). Beneath a rain forest canopy, trichromatic females may well have a fitness advantage from the improved detection of fruit (Osorio et al. 2004Go), arthropod prey (Surridge and Mundy 2002Go), russet-colored predators (Coss and Ramakrishnan 2000Go), or any ecologically relevant object requiring high spatial resolution (Blessing et al. 2004Go).

The allele frequencies we observed are germane to this issue. The P535, P549, and P562 alleles were present, respectively, in 45%, 10%, and 45% of the 29 X chromosomes we studied. The infrequency of the P549 allele may have arisen because trichromatic vision favors a wide spectral separation between M/L pigments and equal frequencies of the P535 and P562 alleles, whereas in dichromats, long wavelength alleles are more fit (Osorio et al. 2004Go; cf., Surridge, Suárez, Buchanan-Smith, Smith et al. 2005Go). Yet, models of fruit detectability suggest that the advantage of the P562 allele to a dichromat is small and inconsistent between fruits (Osorio et al. 2004Go). Future studies with access to a larger data set should test if phenotypes with a wider spectral separation of M/L pigments enjoy energetic advantages. Importantly, the allele frequencies we observed differ from those reported from the nearby site of Santa Rosa National Park, Costa Rica. The combined frequencies of the P530, P545, and P560 alleles in 2 C. capucinus populations were 8%, 14%, and 78%, respectively (Hiramatsu et al. 2005Go). One group, CP, consisted of dichromats only (n = 17 individuals). The authors suggested that the allelic diversity of CP has been homogenized by genetic inbreeding. The avoidance of inbreeding may be one of the major factors contributing to the maintenance of M/L alleles among platyrrhines (Surridge, Suárez, Buchanan-Smith et al. 2005Go).

More research, particularly in the field, is needed to understand the maintenance of the color vision polymorphism of platyrrhine primates. Our study is the first to examine the hypothesized foraging advantage of trichromatic females in the wild. Contrary to the assumptions of previous theoretical and experimental studies, our analysis of C. capucinus foraging behavior suggests that trichromats may not enjoy an energetic advantage over dichromats when foraging on fruit in a tropical deciduous forest. The M/L cone opsin polymorphism of platyrrhines might instead allow for a wide range of visual advantages that could potentially serve to maintain the adaptation.


    ACKNOWLEDGEMENTS
 
We are grateful for the intellectual and material contributions of A. Chaine, C.H. Janson, W.-H. Li, P.W. Lucas, B.L.W. Miller, P.J. Perry, J.N. Thompson, S. Yi, and the UC-Santa Cruz Molecular Ecology and Evolutionary Genetics Facility. We are grateful for the field assistance of A.F. Jiménez, J.C. Ordonez, Y. Teplitsky, T. Pendergast, and A. Cronin. We received research permission from the Costa Rican Servicio de Parques Nacionales (MINAE), ACT, and Finca El Pelón de la Bajura. The Institutional Animal Care and Use Committee of Stony Brook University approved our protocols. E.R.V. received funding from the National Science Foundation (DIG 23720-1021441-1), the Leakey Foundation (431-1770A), the Organization for Tropical Studies, a Graduate Aid in Areas of National Need Fellowship, and the Department of Ecology and Evolution, Stony Brook University (Slobodkin Research and Sokal Travel Awards). N.J.D. received a Ruth L. Kirchenstein National Institute of General Medical Sciences National Service Research Award and support from the UC-Santa Cruz Committee on Research.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Asenjo AB, Rim J, Oprian DD. (1994) Molecular determinants of human red/green color discrimination. Neuron 12:1131–1138.[CrossRef][Web of Science][Medline]

Blessing EM, Solomon SG, Hashemi-Nezhad M, Morris BJ, Martin PR. (2004) Chromatic and spatial properties of parvocellular cells in the lateral geniculate nucleus of the marmoset (Callithrix jacchus). J Physiol 557:229–245.[Abstract/Free Full Text]

Boissinot S, Tan Y, Shyue SK, Schneider H, Sampaio I, Neiswanger K, Hewett-Emmett D, Li W-H. (1998) Origins and antiquity of X-linked triallelic color vision systems in New World monkeys. Proc Natl Acad Sci USA 95:13749–13754.[Abstract/Free Full Text]

Bowmaker JK, Mollon JD, Jacobs GH. (1983) Microspectrophotometric measurements of Old and New World species of monkeys. In Mollon JD and Sharpe LT (Eds.). Colour vision—physiology and psychophysics(Academic Press, London) pp. 56–68.

Burns JG. (2005) Impulsive bees forage better: the advantage of quick, sometimes inaccurate foraging decisions. Anim Behav 70:e1–e5.[CrossRef]

Caine NG and Mundy NI. (2000) Demonstration of a foraging advantage for trichromatic marmosets (Callithrix geoffroyi) dependent on food colour. Proc R Soc Lond B Biol Sci 267:39–444.

Chapman CA. (1987) Flexibility in diets of three species of Costa Rica primates. Folia Primatol (Basel) 49:90–105.[CrossRef]

Chittka L, Dyer AG, Bock F, Dornhaus A. (2003) Bees trade off foraging speed for accuracy. Nature 424:388.[CrossRef][Medline]

Cole BL, Maddocks JD, Sharpe K. (2004) Visual search and the conspicuity of coloured targets for color vision normal and colour vision deficient observers. Clin Exp Optom 87:294–304.[Medline]

Coss RG and Ramakrishnan U. (2000) Perceptual aspects of leopard recognition by wild bonnet macaques (Macaca radiata). Behaviour 137:315–335.[CrossRef][Web of Science]

Crone EE. (2001) Is survivorship a better fitness surrogate than fecundity? Evolution 55:2611–2614.[CrossRef][Web of Science][Medline]

Cropp S, Boinski S, Li W-H. (2002) Allelic variation in the squirrel monkey X-linked color vision gene: biogeographical and behavioral correlates. J Mol Evol 54:734–745.[CrossRef][Web of Science][Medline]

Dall SRX, Giraldeau L-A, Olsson O, McNamara JM, Stephens DW. (2005) Information and its use by animals in evolutionary ecology. Trends Ecol Evol 20:187–193.[CrossRef][Medline]

Dyer AG and Chittka L. (2004) Bumblebees (Bombus terrestris) sacrifice foraging speed to solve difficult colour discrimination tasks. J Comp Physiol A 190:759–763.[Web of Science][Medline]

Enquist BJ and Sullivan JJ. (2001) Vegetative key and descriptions of tree species of the tropical dry forests of upland Sector Santa Rosa, Area de Conservación Guanacaste, Costa Rica [Internet]. Available from: http://www.acguanacaste.ac.cr/paginas_especie/plantae_online/EnquistSullivanTreeKey.pdf. Accessed 18 Aug 2006.

Frankie GW, Vinson SB, Newstrom LE, Barthell JF. (1988) Nest site and habitat preferences of Centris bees in the Costa Rican dry forest. Biotropica 20:301–310.[CrossRef][Web of Science]

Hiramatsu C, Tsutsui T, Matsumoto Y, Aurelli F, Fedigan LM, Kawamura S. (2005) Color vision polymorphism in wild capuchins (Cebus capucinus) and spider monkeys (Ateles geoffroyi) in Costa Rica. Am J Primatol 67:447–461.[CrossRef][Web of Science][Medline]

Hunt DM, Dulai KS, Cowing JA, Julliot C, Mollon JD, Bowmaker JK, Li W-H, Hewett-Emmett D. (1998) Molecular evolution of trichromacy in primates. Vision Res 38:3299–3306.[CrossRef][Web of Science][Medline]

Jacobs GH and Deegan JF 2nd. (2003) Cone pigment variations in four genera of new world monkeys. Vision Res 43:227–236.[CrossRef][Web of Science][Medline]

Jacobs GH and Neitz J. (1987) Polymorphism of the middle wavelength cone in two species of South American monkey: Cebus apella and Callicebus moloch. Vision Res 27:1263–1268.[CrossRef][Web of Science][Medline]

Jacobs GH, Neitz J, Neitz M. (1993) Genetic basis of polymorphism in the color vision of platyrrhine monkeys. Vision Res 33:269–274.[CrossRef][Web of Science][Medline]

Janson CH. (1985) Aggressive competition and individual food consumption in wild brown capuchin monkeys (Cebus apella). Behav Ecol Sociobiol 18:125–138.[CrossRef][Web of Science]

Knapp LA. (2005) The ABCs of MHC. Evol Anthropol 14:28–37.[CrossRef][Web of Science]

Lee BB, Silveira LCL, Yamada ES, Hunt DM, Kremers J, Martin PR, Troy JB, da Silva-Filho M. (2000) Visual responses of ganglion cells of a New-World primate, the capuchin monkey, Cebus apella. J Physiol 528:573–590.[Abstract/Free Full Text]

Lucas PW, Dominy NJ, Riba-Hernández P, Stoner KE, Yamashita N, Loría-Calderón E, Petersen-Pereira W, Rojas-Durán Y, Salas-Pena R, Solis-Madrigal S, et al. (2003) Evolution and function of routine trichromatic vision in primates. Evolution 57:2636–2643.[CrossRef][Web of Science][Medline]

Merbs SL and Nathans J. (1992) Absorption spectra of human cone pigments. Nature 356:433–435.[CrossRef][Medline]

Mollon JD. (1989) "Tho' she kneel'd in that place where they grew ..." The uses and origins of primate color vision. J Exp Biol 146:21–38.[Abstract/Free Full Text]

Mollon JD, Bowmaker JK, Jacobs GH. (1984) Variations of colour vision in a New World primate can be explained by polymorphism of retinal photopigments. Proc R Soc Lond B Biol Sci 222:373–399.[Medline]

Nathans J, Thomas D, Hogness DS. (1986) Molecular genetics of inherited variation in human color vision. Science 232:203–222.[Abstract/Free Full Text]

Neitz M and Neitz J. (1995) Numbers and ratios of visual pigment genes for normal red-green color vision. Science 267:1013–1016.[Abstract/Free Full Text]

Neitz M and Neitz J. (1998) Molecular genetics and the biological basis of color vision. In Backhaus WGK, Kliegl R, Werner JS (Eds.). Color vision: perspectives from different disciplines(Walter de Gruyter, Berlin (Germany)) pp. 101–119.

Neitz M, Neitz J, Jacobs GH. (1991) Spectral tuning of pigments underlying red-green color vision. Science 252:972–974.

Nsubuga AM, Robins MM, Roeder AD, Morin PA, Boesch C, Vigilant L. (2004) Factors affecting the amount of genomic DNA extracted from ape faeces and the identification of an improved sample storage method. Mol Ecol 13:2089–2094.[CrossRef][Medline]

Osorio D, Smith AC, Vorobyev M, Buchanan-Smith HM. (2004) Detection of fruit and the selection of primate visual pigments for color vision. Am Nat 164:696–708.[CrossRef][Web of Science]

Párraga CA, Troscianko T, Tolhurst DJ. (2002) Spatiochromatic properties of natural images and human vision. Curr Biol 12:483–487.[CrossRef][Web of Science][Medline]

Regan BC, Julliot C, Simmen B, Viénot F, Charles-Dominique P, Mollon JD. (2001) Fruits, foliage and the evolution of primate colour vision. Philos Trans R Soc Lond B Biol Sci 356:229–283.[Abstract/Free Full Text]

Riba-Hernández P, Stoner KE, Lucas PW. (2005) Sugar concentration of fruits and their detection via color in the Central American spider monkey (Ateles geoffroyi). Am J Primatol 67:411–423.[CrossRef][Web of Science][Medline]

Riba-Hernández P, Stoner KE, Osorio D. (2004) Effect of polymorphic colour vision for fruit detection in the spider monkey Ateles geoffroyi, and its implications for the maintenance of polymorphic colour vision in platyrrhine monkeys. J Exp Biol 207:2465–2470.[Abstract/Free Full Text]

Rowe MP and Jacobs GH. (2004) Cone pigment polymorphism in New World monkeys: are all pigments created equal? Vis Neurosci 21:217–222.[Web of Science][Medline]

Saito A, Kawamura S, Mikami A, Ueno Y, Hiramatsu C, Koida K, Fujita K, Kuroshima H, Hasegawa T. (2005) Demonstration of a genotype-phenotype correlation in the polymorphic color vision of a non-callitrichine New World Monkey, capuchin (Cebus apella). Am J Primatol 67:471–485.[CrossRef][Web of Science][Medline]

Sall J, Lehman A, Creighton L. (2001) JMP® Start Statistics: A Guide to Statistics and Data Analysis. (Thomas Learning, Duxbury (CA)).

Schmidt V and Schaefer HM. (2004) Unlearned preference for red may facilitate recognition of palatable food in young omnivorous birds. Evol Ecol Res 6:919–925.

Schmidt V, Schaefer HM, Winkler H. (2004) Conspicuousness, not colour as foraging cue in plant-animal signaling. Oikos 106:551–557.[CrossRef][Web of Science]

Shyue SK, Boissinot S, Schneider H, Sampaio I, Schneider MP, Abee CR, Williams L, Hewett-Emmett D, Sperling HG, Cowing JA, et al. (1998) Molecular genetics of spectral tuning in New World monkey color vision. J Mol Evol 46:697–702.[CrossRef][Web of Science][Medline]

Smith AC, Buchanan-Smith HM, Surridge AK, Osorio D, Mundi NI. (2003) The effect of colour vision status on the detection and selection of fruits by tamarins (Saguinus spp.). J Exp Biol 206:3159–3165.[Abstract/Free Full Text]

Sokal RS and Rohlf FJ. (1995) Biometry 3rd ed (W.H. Freeman, New York).

Stoner KE, Riba-Hernández P, Lucas PW. (2005) Comparative use of color vision for frugivory by sympatric species of platyrrhines. Am J Primatol 67:399–409.[CrossRef][Web of Science][Medline]

Surridge AK and Mundy NI. (2002) Trans-specific evolution of opsin alleles and the maintenance of trichromatic colour vision in callitrichine primates. Mol Ecol 11:2157–2169.[CrossRef][Medline]

Surridge AK, Osorio D, Mundy NI. (2003) Evolution and selection of trichromatic vision in primates. Trends Ecol Evol 18:198–205.[CrossRef]

Surridge AK, Suárez SS, Buchanan-Smith HM, Mundy NI. (2005a) Non-random association of opsin alleles in wild groups of red-bellied tamarins (Saguinus labiatus) and maintenance of the colour vision polymorphism. Biol Lett 1:465–468.[Abstract/Free Full Text]

Surridge AK, Suárez SS, Buchanan-Smith HM, Smith AC, Mundy NI. (2005b) Color vision pigment frequencies in wild tamarins (Saguinus spp.). Am J Primatol 67:463–470.[CrossRef][Web of Science][Medline]

Talebi MG, Pope TR, Vogel ER, Neitz M, Dominy NJ. (2006) Polymorphism of visual pigment genes in the muriqui (Primates, Atelidae). Mol Ecol 15:551–558.[CrossRef][Medline]

Vogel ER. (2004) The ecological basis of aggression in white-faced capuchin monkeys, Cebus capucinus, in a Costa Rican dry forest [PhD dissertation]. (Stony Brook University, Stony Brook (NY)).

Vogel ER. (2005) Rank differences in energy intake rates in white-faced capuchin monkeys, Cebus capucinus: the effects of contest competition. Behav Ecol Sociobiol 58:333–444.[CrossRef][Web of Science]

Yamashita N, Stoner KE, Riba-Hernández P, Dominy NJ, Lucas PW. (2005) Light levels used during feeding by primate species with different color vision phenotypes. Behav Ecol Sociobiol 58:618–629.[CrossRef][Web of Science]

Yokoyama S and Radlwimmer FB. (2001) The molecular genetics and evolution of red and green color vision in vertebrates. Genetics 158:1697–1710.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
T. Hiwatashi, Y. Okabe, T. Tsutsui, C. Hiramatsu, A. D. Melin, H. Oota, C. M. Schaffner, F. Aureli, L. M. Fedigan, H. Innan, et al.
An Explicit Signature of Balancing Selection for Color-Vision Variation in New World Monkeys
Mol. Biol. Evol., February 1, 2010; 27(2): 453 - 464.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
G. H. Jacobs
Evolution of colour vision in mammals
Phil Trans R Soc B, October 12, 2009; 364(1531): 2957 - 2967.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
C. J. Leary
Hormones and acoustic communication in anuran amphibians
Integr. Comp. Biol., October 1, 2009; 49(4): 452 - 470.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
B. R. Conway
Color Vision, Cones, and Color-Coding in the Cortex
Neuroscientist, June 1, 2009; 15(3): 274 - 290.
[Abstract] [PDF]


Home page
J. Exp. Biol.Home page
H. R. Goerlitz, S. Greif, and B. M. Siemers
Cues for acoustic detection of prey: insect rustling sounds and the influence of walking substrate
J. Exp. Biol., September 1, 2008; 211(17): 2799 - 2806.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/2/292    most recent
arl082v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Vogel, E. R.
Right arrow Articles by Dominy, N. J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Vogel, E. R.
Right arrow Articles by Dominy, N. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?